agv_navigation_ws/fast_gicp/thirdparty/nvbio/contrib/htslib/faidx.5

'\" t
.TH faidx 5 "August 2013" "htslib" "Bioinformatics formats"
.SH NAME
faidx \- an index enabling random access to FASTA files
.SH SYNOPSIS
.IR file.fa .fai,
.IR file.fasta .fai
.SH DESCRIPTION
Using an \fBfai index\fP file in conjunction with a FASTA file containing
reference sequences enables efficient access to arbitrary regions within
those reference sequences.
The index file typically has the same filename as the corresponding FASTA
file, with \fB.fai\fP appended.
.P
An \fBfai index\fP file is a text file consisting of lines each with
five TAB-delimited columns:
.TS
lbl.
NAME	Name of this reference sequence
LENGTH	Total length of this reference sequence, in bases
OFFSET	Offset within the FASTA file of this sequence's first base
LINEBASES	The number of bases on each line
LINEWIDTH	The number of bytes in each line, including the newline
.TE
.P
The \fBNAME\fP and \fBLENGTH\fP columns contain the same
data as would appear in the \fBSN\fP and \fBLN\fP fields of a
SAM \fB@SQ\fP header for the same reference sequence.
.P
The \fBOFFSET\fP column contains the offset within the FASTA file, in bytes
starting from zero, of the first base of this reference sequence, i.e., of
the character following the newline at the end of the "\fB>\fP" header line.
Typically the lines of a \fBfai index\fP file appear in the order in which the
reference sequences appear in the FASTA file, so \fB.fai\fP files are typically
sorted according to this column.
.P
The \fBLINEBASES\fP column contains the number of bases in each of the sequence
lines that form the body of this reference sequence, apart from the final line
which may be shorter.
The \fBLINEWIDTH\fP column contains the number of \fIbytes\fP in each of
the sequence lines (except perhaps the final line), thus differing from
\fBLINEBASES\fP in that it also counts the bytes forming the line terminator.
.SS FASTA Files
In order to be indexed with \fBsamtools faidx\fP, a FASTA file must be a text
file of the form
.LP
.RS
.RI > name
.RI [ description ...]
.br
ATGCATGCATGCATGCATGCATGCATGCAT
.br
GCATGCATGCATGCATGCATGCATGCATGC
.br
ATGCAT
.br
.RI > name
.RI [ description ...]
.br
ATGCATGCATGCAT
.br
GCATGCATGCATGC
.br
[...]
.RE
.LP
In particular, each reference sequence must be "well-formatted", i.e., all
of its sequence lines must be the same length, apart from the final sequence
line which may be shorter.
(While this sequence line length must be the same within each sequence,
it may vary between different reference sequences in the same FASTA file.)
.P
This also means that although the FASTA file may have Unix- or Windows-style
or other line termination, the newline characters present must be consistent,
at least within each reference sequence.
.P
The \fBsamtools\fP implementation uses the first word of the "\fB>\fP" header
line text (i.e., up to the first whitespace character) as the \fBNAME\fP column.
At present, there may be no whitespace between the
">" character and the \fIname\fP.
.SH EXAMPLE
For example, given this FASTA file
.LP
.RS
>one
.br
ATGCATGCATGCATGCATGCATGCATGCAT
.br
GCATGCATGCATGCATGCATGCATGCATGC
.br
ATGCAT
.br
>two another chromosome
.br
ATGCATGCATGCAT
.br
GCATGCATGCATGC
.br
.RE
.LP
formatted with Unix-style (LF) line termination, the corresponding fai index
would be
.RS
.TS
lnnnn.
one	66	5	30	31
two	28	98	14	15
.TE
.RE
.LP
If the FASTA file were formatted with Windows-style (CR-LF) line termination,
the fai index would be
.RS
.TS
lnnnn.
one	66	6	30	32
two	28	103	14	16
.TE
.RE
.SH SEE ALSO
.IR samtools (1)
.TP
http://en.wikipedia.org/wiki/FASTA_format
Further description of the FASTA format